rss
Arch Dis Child Fetal Neonatal Ed 2005;90:F187 doi:10.1136/adc.2004.062661
  • LETTER

Neonatal buccal cell collection for DNA analysis

  1. G Gavriel1,
  2. N Modi1,
  3. P Stanier2,
  4. G E Moore2
  1. 1Faculty of Medicine, Division of Paediatrics, Obstetrics and Gynaecology, Imperial College London, Chelsea & Westminster Hospital, 369 Fulham Road, London SW10 9NH, UK
  2. 2Faculty of Medicine, Division of Paediatrics, Obstetrics and Gynaecology, Institute of Reproductive and Developmental Biology, Imperial College London, Du Cane Road, London W12 0NN, UK
  1. Correspondence to:
    Dr Modi
    n.modiimperial.ac.uk

    It is considered undesirable to take blood from an infant as a means of obtaining DNA for research purposes. Sufficient DNA for direct gene analysis can be obtained from adult buccal epithelial cells,1 but there is no evidence that neonatal buccal epithelial cells can similarly be used. We have carried out a preliminary study, approved by the Riverside Research Ethics Committee, to determine the ease of isolating neonatal buccal cells for DNA extraction followed by polymerase chain reaction (PCR) and sequence analysis.

    Buccal cells were obtained from eight term and four preterm infants after informed parental consent. A standard microbiological cotton swab or cotton dental roll was rubbed on the inner cheek, and the baby was allowed to suck on it for 30 seconds. The infants were unperturbed by the procedure and mothers found it very acceptable.

    Swabs/dental rolls were placed in 0.9% sodium chloride and centrifuged to concentrate the cells into a pellet. The cells were lysed with a standard lysis buffer, and DNA was extracted using a simple phenol/chloroform technique.2 Spectrophotometry to measure the A260/A280 ratio in order to assess purity of the extracted DNA was carried out using an Eppendorf Biophotometer V1.20. DNA concentration and yield were calculated from UV absorbance at 260 nm (A260). To show that the DNA obtained could be analysed at the single base level, PCR was carried out with the primers AACACTGGTGGCGCAGAAAT (forward) and TGGGTGCACCTCTCACAGAA (reverse) to amplify exon 22 of the human SCRIBBLE gene. PCR products were viewed on a 1% agarose gel with a UV transilluminator, sequenced using BigDye v3.0 chemistry (PE Applied Biosystems, Warrington, UK) and run on an ABI 3100 Genetic Analyser. Sequence alignment with the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/) was used to confirm accurate sequence amplification.

    Spectrophotometry confirmed successful DNA extraction from all samples with a mean DNA yield of 6.65 μg (SD 4.07; range 1.65–16.40). This compares favourably with DNA yields obtained in similar studies with adult and child subjects where yields of 2–85 μg have been described.3,4 Sequences matching exon 22 of SCRIBBLE were successfully obtained using both forward and reverse primers. The mean A260/A280 ratio of samples in this work was 1.27 (SD 0.07; range 1.20–1.42). High quality DNA has an A260/A280 ratio of about 1.80.

    This preliminary study has shown that buccal cells can easily be obtained from term and preterm infants in sufficient quantity for DNA extraction, PCR, and sequencing. The technique is simple and non-invasive and we hope will facilitate neonatal research.

    Footnotes

    • Competing interests: none declared

    References

    This Article

    Services

    1. Request permissions

    Responses

    1. Submit a response
    2. No responses published

    Social bookmarking

    Latest from Education & Practice

    Latest from Education & Practice

    Register for free content

    Free sample
    This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of ADC Fetal & Neonatal.
    View free sample issue >>

    Free archive
    The full back archive is now available for ADC Fetal & Neonatal. Institutional subscribers may access the entire archive as part of their subscription. Personal subscribers will also have access to all content when logged in. Non-subscribers who register have free access to all articles published before 2006, back to volume 1 issue 1.
    Register to access the free archive >>

    Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.

  • Paediatrics and Paediatric Surgery Jobs

    Paediatrics and Paediatric Surgery Jobs